AAVS1-PuroR Xlone eGFP
(Plasmid
#179837)
-
PurposeDoxycycline-inducible expression of eGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAddgene #136936
- Backbone size w/o insert (bp) 9657
- Total vector size (bp) 10374
-
Vector typeMammalian Expression, CRISPR, TALEN, Synthetic Biology ; Donor plasmid
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)717
- Promoter TRE3GS
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer cgcctgtcttaggttggagt (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid is identical to Addgene plasmid # 136936 except it does not contain the WPRE sequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-PuroR Xlone eGFP was a gift from Xiaoping Bao (Addgene plasmid # 179837 ; http://n2t.net/addgene:179837 ; RRID:Addgene_179837) -
For your References section:
Temporal Expression of Transcription Factor ID2 Improves Natural Killer Cell Differentiation from Human Pluripotent Stem Cells. Jung J, Chang Y, Jin G, Lian X, Bao X. ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017. 10.1021/acssynbio.2c00017 PubMed 35608547