pBPK1520-HEK3-CTTins-ng
(Plasmid
#180019)
-
PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of HEK3 CTT insertion in PE3 approach
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneBPK1520
-
Backbone manufacturerKeith Joung (Addgene plasmid # 65777)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePrime editing ngRNA for HEK3-CTTins
-
gRNA/shRNA sequenceGTCAACCAGTATCCCGGTGC
-
SpeciesH. sapiens (human)
-
Insert Size (bp)21
-
Entrez GeneEPHA8 (a.k.a. EEK, EK3, HEK3)
- Promoter Human U7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6-F (GAGGGCCTATTTCCCATGATT) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBackbone is from Keith Joung (Addgene plasmid # 65777)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPK1520-HEK3-CTTins-ng was a gift from Dirk Hockemeyer (Addgene plasmid # 180019 ; http://n2t.net/addgene:180019 ; RRID:Addgene_180019) -
For your References section:
Highly efficient generation of isogenic pluripotent stem cell models using prime editing. Li H, Busquets O, Verma Y, Syed KM, Kutnowski N, Pangilinan GR, Gilbert LA, Bateup HS, Rio DC, Hockemeyer D, Soldner F. Elife. 2022 Sep 7;11:e79208. doi: 10.7554/eLife.79208. 10.7554/eLife.79208 PubMed 36069759