Skip to main content

pET-NlaCascade-NLS-6xHis
(Plasmid #180213)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180213 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET
  • Backbone manufacturer
    pET-based custom vector
  • Backbone size w/o insert (bp) 5203
  • Total vector size (bp) 8526
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    NlaCas5-Cas8-Cas7
  • Alt name
    DR91_RS04460; DR91_RS04455; DR91_RS04450
  • Species
    Neisseria lactamica
  • Insert Size (bp)
    3323
  • GenBank ID
    NZ_KN046803.1
  • Promoter T7
  • Tags / Fusion Proteins
    • NLS (C terminal on insert)
    • 6XHis (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET-NlaCascade-NLS-6xHis was a gift from Yan Zhang (Addgene plasmid # 180213 ; http://n2t.net/addgene:180213 ; RRID:Addgene_180213)
  • For your References section:

    Cas11 enables genome engineering in human cells with compact CRISPR-Cas3 systems. Tan R, Krueger RK, Gramelspacher MJ, Zhou X, Xiao Y, Ke A, Hou Z, Zhang Y. Mol Cell. 2022 Feb 17;82(4):852-867.e5. doi: 10.1016/j.molcel.2021.12.032. Epub 2022 Jan 19. 10.1016/j.molcel.2021.12.032 PubMed 35051351