-
Purposefor bacterial expression of recombinant ratiometric pHluorin2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180227 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a(+)
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsexpression in E.coli BL21(DE3)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRatiometric pHLuorin2
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag followed by thrombin cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RpHLuorin2 was a gift from Geert van den Bogaart (Addgene plasmid # 180227 ; http://n2t.net/addgene:180227 ; RRID:Addgene_180227) -
For your References section:
Fluorescence Lifetime Imaging of pH along the Secretory Pathway. Linders PTA, Ioannidis M, Ter Beest M, van den Bogaart G. ACS Chem Biol. 2022 Jan 21;17(1):240-251. doi: 10.1021/acschembio.1c00907. Epub 2022 Jan 10. 10.1021/acschembio.1c00907 PubMed 35000377