JEC027
(Bacterial strain
#180310)
-
PurposeE. coli MG1655 strain with knockout of endogenous Type I-E CRISPR Cas system
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 180310 | Bacteria in agar stab | 1 | $89 |
Backbone
-
Vector backbonen/a
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)E. coli MG1655ΔCRISPR-Cas
-
Growth instructionsLB with no antibiotics
-
Copy numberUnknown
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Genotype: E. coli MG1655ΔCRISPR-Cas
Method: Knockout using pKD46/pKD4
Created by: Baiyang Liu
Knockout region from MG1655 genome: 995605 to 1006007
Primer Fw: GATTATCGACTGGGATAACC
Primer Rv: CAGAAATATTCGACAAAGCG
Expected PCR size for JEC027: 1kb
Expected PCR size for MG1655: 10.4kb
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
JEC027 was a gift from James Chappell (Addgene plasmid # 180310) -
For your References section:
Uncovering the Distinct Properties of a Bacterial Type I-E CRISPR Activation System. Villegas Kcam MC, Tsong AJ, Chappell J. ACS Synth Biol. 2022 Jan 25. doi: 10.1021/acssynbio.1c00496. 10.1021/acssynbio.1c00496 PubMed 35077145