Skip to main content

pAR100
(Plasmid #180377)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 180377 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSELECT-GFPzeo-mcs
  • Backbone manufacturer
    Invivogen
  • Backbone size w/o insert (bp) 4249
  • Total vector size (bp) 7114
  • Modifications to backbone
    Inserted two multiple cloning sites: one at NheI site (NheI, AflII, ApaI, AscI, BsiWI, BstZ17I, NruI, PstI, SacII, Nhe); another at EcoRI site (EcoRI, KpnI, XbaI, BamHI, SalI, EcoRI); Inserted CD8Aa from pORF9-hCD8Aa (InvivoGen) Inserted NFAT-Luciferase from pGL3-NFAT luciferase
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    NFAT-Luciferase
  • Alt name
    luc+
  • Species
    firefly
  • Insert Size (bp)
    2142
  • Promoter minimal promoter and an NFAT response element

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site kpnI (not destroyed)
  • 3′ cloning site salI (not destroyed)
  • 5′ sequencing primer ACTTGTGGGGTCCTTCTCCT
  • 3′ sequencing primer AATCTCACGCAGGCAGTTCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hCD8A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    719
  • Promoter hEF1-HTLV

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer AGTGCAGGTGCCAGAACATT
  • 3′ sequencing primer CTTAAGGACGTATCTCGCCGAAAGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Invivogen

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAR100 was a gift from Alec Redwood (Addgene plasmid # 180377 ; http://n2t.net/addgene:180377 ; RRID:Addgene_180377)
  • For your References section:

    Abacavir inhibits but does not cause self-reactivity to HLA-B*57:01-restricted EBV specific T cell receptors. Sooda A, Rwandamuriye F, Wanjalla CN, Jing L, Koelle DM, Peters B, Leary S, Chopra A, Calderwood MA, Mallal SA, Pavlos R, Watson M, Phillips EJ, Redwood AJ. Commun Biol. 2022 Feb 16;5(1):133. doi: 10.1038/s42003-022-03058-9. 10.1038/s42003-022-03058-9 PubMed 35173258