W118-1_hRSK3(RPS6KA2)
(Plasmid
#180384)
-
Purposelentiviral transduction of human RSK3 (RPS6KA2) gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneW118-1
- Backbone size w/o insert (bp) 8015
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameRPS6KA2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2202
-
Entrez GeneRPS6KA2 (a.k.a. HU-2, MAPKAPK1C, RSK, RSK3, S6K-alpha, S6K-alpha2, p90-RSK3, p90RSK2, pp90RSK3)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
W118-1_hRSK3(RPS6KA2) was a gift from Huda Zoghbi (Addgene plasmid # 180384 ; http://n2t.net/addgene:180384 ; RRID:Addgene_180384) -
For your References section:
Dual targeting of brain region-specific kinases potentiates neurological rescue in Spinocerebellar ataxia type 1. Lee WS, Lavery L, Rousseaux MWC, Rutledge EB, Jang Y, Wan YW, Wu SR, Kim W, Al-Ramahi I, Rath S, Adamski CJ, Bondar VV, Tewari A, Soleimani S, Mota S, Yalamanchili HK, Orr HT, Liu Z, Botas J, Zoghbi HY. EMBO J. 2021 Apr 1;40(7):e106106. doi: 10.15252/embj.2020106106. Epub 2021 Mar 11. 10.15252/embj.2020106106 PubMed 33709453