pLenti-gRNA-puro
(Plasmid
#180426)
-
PurposeExpresses puromycin resistance gene and scrambled gRNA for stable integration in mammalian cells; useful as control and template for new gRNAs by mutagenesis.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180426 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLenti_puro
- Backbone size w/o insert (bp) 6487
- Total vector size (bp) 6960
-
Modifications to backboneThe CMV promoter in the original pLenti-puro (Addgene #39481) was removed with the restriction enzymes ClaI and BamHI followed by blunting and self-ligation.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNAscr
-
Alt nameUniversal mammalian negative control (scrambled) gRNA
-
gRNA/shRNA sequenceGCACTACCAGAGCTAACTCA
-
Insert Size (bp)467
- Promoter human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer BGH-reverse (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid backbone was pLenti-puro (Addgene #39481) with the CMV promoter removed by ClaI and BamHI double digest followed by blunting and self-ligation/circularization. gRNA scaffold sequence was obtained from Prashant Mali et al (Science, 2013) and made by gene synthesis, TA-cloning into pCR™ 2.1-TOPO™ TA vector, and transfer to modified pLenti-puro using EcoRI.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-gRNA-puro was a gift from Moshe Szyf (Addgene plasmid # 180426 ; http://n2t.net/addgene:180426 ; RRID:Addgene_180426) -
For your References section:
Unraveling the functional role of DNA demethylation at specific promoters by targeted steric blockage of DNA methyltransferase with CRISPR/dCas9. Sapozhnikov DM, Szyf M. Nat Commun. 2021 Sep 29;12(1):5711. doi: 10.1038/s41467-021-25991-9. 10.1038/s41467-021-25991-9 PubMed 34588447