pJJGL001
(Plasmid
#180605)
-
PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-DpbCasX
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180605 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneCustom
- Backbone size w/o insert (bp) 4745
- Total vector size (bp) 8927
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDpbCasX
- Promoter T7
-
Tags
/ Fusion Proteins
- 10x His (N terminal on insert)
- MBP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGCAGGACTCGAGTTCTAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJJGL001 was a gift from Jennifer Doudna (Addgene plasmid # 180605 ; http://n2t.net/addgene:180605 ; RRID:Addgene_180605) -
For your References section:
Chimeric CRISPR-CasX enzymes and guide RNAs for improved genome editing activity. Tsuchida CA, Zhang S, Doost MS, Zhao Y, Wang J, O'Brien E, Fang H, Li CP, Li D, Hai ZY, Chuck J, Brotzmann J, Vartoumian A, Burstein D, Chen XW, Nogales E, Doudna JA, Liu JG. Mol Cell. 2022 Mar 17;82(6):1199-1209.e6. doi: 10.1016/j.molcel.2022.02.002. Epub 2022 Feb 25. 10.1016/j.molcel.2022.02.002 PubMed 35219382