Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

UPB-stomach (UPB1)
(Plasmid #180784)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 180784 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAVrg-CAG-tdTomato-WPRE-SV40 (Addgene, Plasmid #59462)
  • Backbone manufacturer
    Edward Boyden
  • Backbone size w/o insert (bp) 6150
  • Total vector size (bp) 6534
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    humanized ChR2-H134R (partial)
  • Alt name
    hChR2-H134R
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer catcgataccgtcgacatggactatggcggcgctttg
  • 3′ sequencing primer ctgctcgaagcggccgcaaggtagagcatagagggattc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    UPB-stomach (UPB1) was a gift from Rui Chang (Addgene plasmid # 180784 ; http://n2t.net/addgene:180784 ; RRID:Addgene_180784)
  • For your References section:

    A multidimensional coding architecture of the vagal interoceptive system. Zhao Q, Yu CD, Wang R, Xu QJ, Dai Pra R, Zhang L, Chang RB. Nature. 2022 Mar;603(7903):878-884. doi: 10.1038/s41586-022-04515-5. Epub 2022 Mar 16. 10.1038/s41586-022-04515-5 PubMed 35296859