Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
(Plasmid #181745)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 181745 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    BPK764 (Addgene Plasmid #65767)
  • Vector type
    Bacterial Expression ; in vitro transcription; T7 promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    human/zebrafish codon optimized SpCas9
  • Alt name
    BPK848
  • gRNA/shRNA sequence
    GGGCACGGGCAGCTTGCCGG
  • Species
    Synthetic
  • Promoter T7
  • Tag / Fusion Protein
    • NLS(SV40)-3xFLAG (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer oBK311-GCCATTCGATGGTGTCCGG
  • 3′ sequencing primer oBK390-GCAAATTCGACCCGGTCGTCG Chloramphenicol
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848) was a gift from Benjamin Kleinstiver (Addgene plasmid # 181745 ; http://n2t.net/addgene:181745 ; RRID:Addgene_181745)
  • For your References section:

    Precise DNA cleavage using CRISPR-SpRYgests. Christie KA, Guo JA, Silverstein RA, Doll RM, Mabuchi M, Stutzman HE, Lin J, Ma L, Walton RT, Pinello L, Robb GB, Kleinstiver BP. Nat Biotechnol. 2022 Oct 6. pii: 10.1038/s41587-022-01492-y. doi: 10.1038/s41587-022-01492-y. 10.1038/s41587-022-01492-y PubMed 36203014