pcDNA3.1-Muc5b D1 (murine) with cleavable His tag
(Plasmid
#181814)
-
PurposeExpresses murine Muc5b D1 with cleavable His tag, residues 50-426
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMuc5b D1
-
Alt nameMucin 5b D1
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_028801.2
-
Entrez GeneMuc5b (a.k.a. 2300002I04Rik, A130042M24, AV085033, MUC5, MUC9, mucin 5b)
- Promoter CMV
-
Tag
/ Fusion Protein
- TEV cleavage site followed by 6xHistidine tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
6XHistidine tag on the N' terminal side followed by a TEV cleavage site was not cleaved by TEV when tested. Therefore, this version of 6xHistidine tag on the C' terminal side was used.
Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474741v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Muc5b D1 (murine) with cleavable His tag was a gift from Deborah Fass (Addgene plasmid # 181814 ; http://n2t.net/addgene:181814 ; RRID:Addgene_181814) -
For your References section:
Intestinal mucin is a chaperone of multivalent copper. Reznik N, Gallo AD, Rush KW, Javitt G, Fridmann-Sirkis Y, Ilani T, Nairner NA, Fishilevich S, Gokhman D, Chacon KN, Franz KJ, Fass D. Cell. 2022 Oct 27;185(22):4206-4215.e11. doi: 10.1016/j.cell.2022.09.021. Epub 2022 Oct 6. 10.1016/j.cell.2022.09.021 PubMed 36206754