pcDNA3.1-Muc5b D1 (murine) with cleavable His tag
(Plasmid #181814)

• Purpose: Expresses murine Muc5b D1 with cleavable His tag, residues 50-426
• Depositing Lab: Deborah Fass
• Publication: Reznik et al Cell. 2022 Oct 27;185(22):4206-4215.e11. doi: 10.1016/j.cell.2022.09.021. Epub 2022 Oct 6.

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Muc5b D1
• Alt name: Mucin 5b D1
• Species: M. musculus (mouse)
• GenBank ID: NM_028801.2
• Entrez Gene: Muc5b (a.k.a. 2300002I04Rik, A130042M24, AV085033, MUC5, MUC9, mucin 5b)
• Promoter: CMV
• Tag / Fusion Protein:
  • TEV cleavage site followed by 6xHistidine tag (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Supplemental Documents:
  • pcDNA3.1-Muc5b D1 (murine) with cleavable His tag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

6XHistidine tag on the N' terminal side followed by a TEV cleavage site was not cleaved by TEV when tested. Therefore, this version of 6xHistidine tag on the C' terminal side was used.
Please visit https://www.biorxiv.org/content/10.1101/2022.01.02.474741v1 for bioRxiv preprint.