pAAV-shNCLX-1
(Plasmid
#181870)
-
PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 181870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-U6_CaMKIIa-mCherry
-
Vector typeMammalian Expression, Mouse Targeting, Adenoviral, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesolute carrier 8 family member B1
-
Alt nameNCLX
-
Alt namesodium/calcium/lithium exchanger
-
gRNA/shRNA sequenceATGTTGGACTGTGGATCTAAA
-
SpeciesM. musculus (mouse)
-
GenBank IDNM_133221
-
Entrez GeneSlc8b1 (a.k.a. AF261233, NCKX6, NCLX, Slc24a6)
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamhI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer TTGGGTAGTTTGCAGTTTTAAAATT
- 3′ sequencing primer TCACTGAGGAAGCTCTCTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-shNCLX-1 was a gift from Hilmar Bading (Addgene plasmid # 181870 ; http://n2t.net/addgene:181870 ; RRID:Addgene_181870) -
For your References section:
Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149