Skip to main content
Addgene

pAAV-EGFP.T2A.NCLX
(Plasmid #181873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 181873 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CAG
  • Vector type
    Mammalian Expression, Adenoviral, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    solute carrier family 8 member B1
  • Alt name
    NCLX
  • Alt name
    sodium/calcium/lithium exchanger
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1755
  • GenBank ID
    NM_133221
  • Entrez Gene
    Slc8a1 (a.k.a. D930008O12Rik, Ncx1)
  • Promoter synthetic hybrid CAG promoter (follows a T2A signal after EGFP)
  • Tag / Fusion Protein
    • myc (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTG
  • 3′ sequencing primer ACGGGAAGCAATAGCATGATAC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    EGFP
  • Alt name
    enhanced GFP
  • Insert Size (bp)
    717
  • Promoter synthetic hybrid CAG promoter
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Israel Sekler, Department of Physiology and Cell Biology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EGFP.T2A.NCLX was a gift from Hilmar Bading (Addgene plasmid # 181873 ; http://n2t.net/addgene:181873 ; RRID:Addgene_181873)
  • For your References section:

    Disrupted expression of mitochondrial NCLX sensitizes neuroglial networks to excitotoxic stimuli and renders synaptic activity toxic. Hagenston AM, Yan J, Bas-Orth C, Tan Y, Sekler I, Bading H. J Biol Chem. 2021 Dec 20:101508. doi: 10.1016/j.jbc.2021.101508. 10.1016/j.jbc.2021.101508 PubMed 34942149