pU6-Sp-gRNA-AAVS1_B3903c_attP
(Plasmid #182144)

• Purpose: To insert attP attachment site at AAVS1 in human cells via twinPE
• Depositing Lab: David Liu
• Publication: Anzalone et al Nat Biotechnol. 2021 Dec 9. pii: 10.1038/s41587-021-01133-w. doi: 10.1038/s41587-021-01133-w.

Backbone

• Vector backbone: pU6
• Total vector size (bp): 2335
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AAVS1_B3903c_attP pegRNA
• Species: Synthetic
• Insert Size (bp): 152
• Promoter: hU6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: gactatcatatgcttaccgt
• 3′ sequencing primer: TCCTGTTACCAGTGGCTGCT

Resource Information

• Supplemental Documents:
  • pU6-Sp-gRNA-AAVS1_B3903c_attP.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The parent vector used for cloning pegRNA constructs via Golden Gate has been deposited to Addgene previously. The name of the parent vector is pU6-pegRNA-GG-acceptor and the Addgene number is 132777.