Skip to main content
Addgene

pU6-Sp-gRNA-ALB_DF_A277c_attB
(Plasmid #182145)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182145 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pU6
  • Total vector size (bp) 2330
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Alb_A277c_attB pegRNA
  • Species
    Synthetic
  • Insert Size (bp)
    147
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gactatcatatgcttaccgt
  • 3′ sequencing primer TCCTGTTACCAGTGGCTGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The parent vector used for cloning pegRNA constructs via Golden Gate has been deposited to Addgene previously. The name of the parent vector is pU6-pegRNA-GG-acceptor and the Addgene number is 132777.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-Sp-gRNA-ALB_DF_A277c_attB was a gift from David Liu (Addgene plasmid # 182145 ; http://n2t.net/addgene:182145 ; RRID:Addgene_182145)
  • For your References section:

    Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Anzalone AV, Gao XD, Podracky CJ, Nelson AT, Koblan LW, Raguram A, Levy JM, Mercer JAM, Liu DR. Nat Biotechnol. 2022 May;40(5):731-740. doi: 10.1038/s41587-021-01133-w. Epub 2021 Dec 9. 10.1038/s41587-021-01133-w PubMed 34887556