pU6-Sp-gRNA-IDS2_DF_B7b_attP_fwd
(Plasmid
#182150)
-
PurposeTo install attP-fwd attachment site at IDS2 in human cells via twinPE
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182150 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepU6
- Total vector size (bp) 2334
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameIDS2-B7b-attP-fwd pegRNA
-
SpeciesSynthetic
-
Insert Size (bp)151
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gactatcatatgcttaccgt
- 3′ sequencing primer TCCTGTTACCAGTGGCTGCT
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The parent vector used for cloning pegRNA constructs via Golden Gate has been deposited to Addgene previously. The name of the parent vector is pU6-pegRNA-GG-acceptor and the Addgene number is 132777.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-Sp-gRNA-IDS2_DF_B7b_attP_fwd was a gift from David Liu (Addgene plasmid # 182150 ; http://n2t.net/addgene:182150 ; RRID:Addgene_182150) -
For your References section:
Programmable deletion, replacement, integration and inversion of large DNA sequences with twin prime editing. Anzalone AV, Gao XD, Podracky CJ, Nelson AT, Koblan LW, Raguram A, Levy JM, Mercer JAM, Liu DR. Nat Biotechnol. 2022 May;40(5):731-740. doi: 10.1038/s41587-021-01133-w. Epub 2021 Dec 9. 10.1038/s41587-021-01133-w PubMed 34887556