pSLQ9757: CMV-BPNLS_TadA-linkerA-TadA*(8e)-Linker B-SV40 NLS-dCasMINI-V4-linkerC-c-Myc_NLS-3x FLAG-polyA
(Plasmid
#176270)
-
PurposeExpression of TadA-TadA* (8e)-dCasMINI-V4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 176270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTadA-TadA*(8e)-dCasMINI-V4
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gtaacaactccgccccattgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ9757: CMV-BPNLS_TadA-linkerA-TadA*(8e)-Linker B-SV40 NLS-dCasMINI-V4-linkerC-c-Myc_NLS-3x FLAG-polyA was a gift from Stanley Qi (Addgene plasmid # 176270 ; http://n2t.net/addgene:176270 ; RRID:Addgene_176270) -
For your References section:
Engineered miniature CRISPR-Cas system for mammalian genome regulation and editing. Xu X, Chemparathy A, Zeng L, Kempton HR, Shang S, Nakamura M, Qi LS. Mol Cell. 2021 Aug 26. pii: S1097-2765(21)00648-1. doi: 10.1016/j.molcel.2021.08.008. 10.1016/j.molcel.2021.08.008 PubMed 34480847