Skip to main content

pTRIP TRE-BI GFP10-RHOB/RBD-GFP11
(Plasmid #182231)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182231 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRIP TRE
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 10798
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ras homolog family member B
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_004040.4
  • Entrez Gene
    RHOB (a.k.a. ARH6, ARHB, MST081, MSTP081, RHOH6)
  • Promoter TRE bidirectional
  • Tag / Fusion Protein
    • GFP10 (split-GFP tripartite) (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacII (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ATTTCGAGCTCGGTACCG
  • 3′ sequencing primer gtggctaagatctacagctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rhotekin RHO binding domain (RBD)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    252
  • GenBank ID
    NM_001136227.1
  • Promoter TRE bidirectional
  • Tag / Fusion Protein
    • GFP11 (M4) (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CTGGAGAATTCACCGGTCATATG
  • 3′ sequencing primer ggacagcagagatccactt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIP TRE-BI GFP10-RHOB/RBD-GFP11 was a gift from Stéphanie Cabantous (Addgene plasmid # 182231 ; http://n2t.net/addgene:182231 ; RRID:Addgene_182231)
  • For your References section:

    High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation. Koraichi F, Gence R, Bouchenot C, Grosjean S, Lajoie-Mazenc I, Favre G, Cabantous S. J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419. 10.1242/jcs.210419 PubMed 29192060