Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTRIP CMV GFP1-9
(Plasmid #130271)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130271 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRIP CMV
  • Backbone size w/o insert (bp) 9757
  • Total vector size (bp) 10342
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP 1-9 OPT
  • Species
    Synthetic
  • Promoter CMV
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer AGGTGTGACTGGAAAACCCACCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIP CMV GFP1-9 was a gift from Stéphanie Cabantous (Addgene plasmid # 130271 ; http://n2t.net/addgene:130271 ; RRID:Addgene_130271)
  • For your References section:

    High-content tripartite split-GFP cell-based assays to screen for modulators of small GTPase activation. Koraichi F, Gence R, Bouchenot C, Grosjean S, Lajoie-Mazenc I, Favre G, Cabantous S. J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419. 10.1242/jcs.210419 PubMed 29192060