pTRIP TRE-BI GFP10-RHOA/RBD-GFP11
(Plasmid #182232)

• Purpose: Inducible coexpression of GFP10-RHOA and RBD-GFP11 domain
• Depositing Lab: Stéphanie Cabantous
• Publication: Koraichi et al J Cell Sci. 2018 Jan 8;131(1). pii: jcs.210419. doi: 10.1242/jcs.210419.

Backbone

• Vector backbone: pTRIP TRE
• Backbone size w/o insert (bp): 10000
• Total vector size (bp): 10798
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ras homolog family member A
• Species: H. sapiens (human)
• GenBank ID: NM 001313944
• Entrez Gene: RHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
• Promoter: TRE bidirectional
• Tag / Fusion Protein:
  • GFP10 (split-GFP tripartite) (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacII (unknown if destroyed)
• 3′ cloning site: NheI (unknown if destroyed)
• 5′ sequencing primer: ATTTCGAGCTCGGTACCG
• 3′ sequencing primer: gtggctaagatctacagctg

Gene/Insert 2

• Gene/Insert name: rhotekin RHO binding domain (RBD)
• Species: M. musculus (mouse)
• Insert Size (bp): 252
• GenBank ID: NM_001136227.1
• Promoter: TRE bidirectional
• Tag / Fusion Protein:
  • GFP11 (M4) (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CTGGAGAATTCACCGGTCATATG
• 3′ sequencing primer: ggacagcagagatccactt

Resource Information

• Supplemental Documents:
  • pTRIP TREBI 11-RBD 10-RhoA .gbk
  • pTRIP TREBI 11-RBD 10-RhoA .gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry