pAW2-Smed-Slit-1
(Plasmid
#182264)
-
PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea Slit-1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDL1
-
Backbone manufacturerDaniel Lobo
- Backbone size w/o insert (bp) 2319
- Total vector size (bp) 3053
-
Vector typeGibson cloning vector for synthesis of single and double stranded RNA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSmed-Slit-1
-
Alt namedd_Smed_v6_12111_0_1
-
SpeciesSchmidtea mediterranea
-
Insert Size (bp)860
-
GenBank IDDQ336176
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTTGCCAGTCACCAATCATA
- 3′ sequencing primer TTTTCCCATGAAATGGATAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use the vector for in vitro synthesis of sense and antisense riboprobes with T3 and SP6, respectively, and dsRNA with T7.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAW2-Smed-Slit-1 was a gift from Daniel Lobo (Addgene plasmid # 182264 ; http://n2t.net/addgene:182264 ; RRID:Addgene_182264) -
For your References section:
In situ probe and inhibitory RNA synthesis using streamlined gene cloning with Gibson assembly. Wolff A, Wagner C, Wolf J, Lobo D. STAR Protoc. 2022 Jun 14;3(3):101458. doi: 10.1016/j.xpro.2022.101458. eCollection 2022 Sep 16. 10.1016/j.xpro.2022.101458 PubMed 35733605