pQE31-6xHis-Countdown
(Plasmid #182299)

• Purpose: E. coli plasmid encoding Countdown with a hexahistidine tag
• Depositing Lab: Andrew York
• Publication: Seidel et al (2021), doi: 10.5281/zenodo.5810930

Backbone

• Vector backbone: pQE31
• Backbone size w/o insert (bp): 3435
• Total vector size (bp): 4152
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Countdown
• Species: Echinophyllia sp. SC22
• Insert Size (bp): 717
• Promoter: T5
• Tag / Fusion Protein:
  • histidine tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: HindIII (destroyed during cloning)
• 5′ sequencing primer: GAGGCCCTTTCGTCTTCAC
• 3′ sequencing primer: GCCATTGGGATATATCAACGG

Resource Information

• Supplemental Documents:
  • pQE31-6xHis-Countdown.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930

Please note: Plasmid contains a frameshift and early termination in the CmR (Chloramphenicol) resistance marker likely compromising it's function.