pQE31-6xHis-pHCountdown
(Plasmid
#182300)
-
PurposeE. coli plasmid encoding pH-Countdown with a hexahistidine tag
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182300 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE31
- Backbone size w/o insert (bp) 3435
- Total vector size (bp) 4152
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepH Countdown
-
SpeciesEchinophyllia sp. SC22
-
Insert Size (bp)717
- Promoter T5
-
Tag
/ Fusion Protein
- histidine tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (destroyed during cloning)
- 5′ sequencing primer GAGGCCCTTTCGTCTTCAC
- 3′ sequencing primer GCCATTGGGATATATCAACGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930
Please note: Plasmid contains a frameshift and early termination in the CmR (Chloramphenicol) resistance marker likely compromising it's function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQE31-6xHis-pHCountdown was a gift from Andrew York (Addgene plasmid # 182300 ; http://n2t.net/addgene:182300 ; RRID:Addgene_182300) -
For your References section:
Relaxation Sensors. Seidel ZP, Wang JCK, Riegler J, York AG, Ingaramo M. (2021), doi: 10.5281/zenodo.5810930 10.5281/zenodo.5810930