pCDH-EF1-pHCountdown
(Plasmid
#182301)
-
Purposelentiviral plasmid encoding pH-Countdown and puromycin selection
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH
- Backbone size w/o insert (bp) 8429
- Total vector size (bp) 9144
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepH countdown
-
SpeciesEchinophyllia sp. SC22
-
Insert Size (bp)717
- Promoter EF-1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer cgtaaaaggagcaacatagttaag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-EF1-pHCountdown was a gift from Andrew York (Addgene plasmid # 182301 ; http://n2t.net/addgene:182301 ; RRID:Addgene_182301) -
For your References section:
Relaxation Sensors. Seidel ZP, Wang JCK, Riegler J, York AG, Ingaramo M. (2021), doi: 10.5281/zenodo.5810930 10.5281/zenodo.5810930