pRSET-TorA-6xHis-M13-pHCountdown-Calmodulin
(Plasmid
#182305)
-
PurposeE. coli plasmid encoding a fusion between pH-Countdown and the calcium-binding domains of GECO 1.2 with a hexahistidine tag, targeted to the periplasm via the TorA presequence.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182305 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRSETB
- Backbone size w/o insert (bp) 2760
- Total vector size (bp) 4236
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepH-Countdown insertion into GECO 1.2 calcium sensing domains
-
SpeciesEchinophyllia sp. SC22
-
Insert Size (bp)1642
-
MutationSpontaneous mutation of calmodulin's penultimate residue to a threonine, which does not seem to perturb calcium binding
- Promoter t7
-
Tags
/ Fusion Proteins
- A modified TorA periplasmic targeting sequence plus a histidine tag (N terminal on insert)
- non-translated SSrA degradation signal (after the stop codon) (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint here: https://andrewgyork.github.io/relaxation_sensors/, doi:10.5281/zenodo.5810930
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRSET-TorA-6xHis-M13-pHCountdown-Calmodulin was a gift from Andrew York (Addgene plasmid # 182305 ; http://n2t.net/addgene:182305 ; RRID:Addgene_182305) -
For your References section:
Relaxation Sensors. Seidel ZP, Wang JCK, Riegler J, York AG, Ingaramo M. (2021), doi: 10.5281/zenodo.5810930 10.5281/zenodo.5810930