pCAG-ArcLight-ST
(Plasmid
#182318)
-
PurposeFluorescent voltage indicator with left-shifted voltage-dependency
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4831
- Total vector size (bp) 6295
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArcLight-ST
-
SpeciesSynthetic
-
Insert Size (bp)1464
-
MutationMutation in an amino acid Q217E of ArcLight-MT
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGGTTATTGTGCTGTCTCAT
- 3′ sequencing primer CAGCCACCACCTTCTGATA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-ArcLight-ST was a gift from Rafael Yuste (Addgene plasmid # 182318 ; http://n2t.net/addgene:182318 ; RRID:Addgene_182318) -
For your References section:
Simultaneous two-photon imaging of action potentials and subthreshold inputs in vivo. Bando Y, Wenzel M, Yuste R. Nat Commun. 2021 Dec 10;12(1):7229. doi: 10.1038/s41467-021-27444-9. 10.1038/s41467-021-27444-9 PubMed 34893595