-
PurposeExpresses PfuX7 DNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 4000
-
Vector typeBacterial Expression
-
Selectable markersKanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePfuX7 DNA polymerase
-
SpeciesPyrococcus furiosus
-
Insert Size (bp)2535
-
MutationV93Q
- Promoter T7
-
Tag
/ Fusion Protein
- His-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer atgattttagatgtggattacataactgaagaaggaaaac
- 3′ sequencing primer cagatgctggagaagcagaaaaagtga (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484273v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-PfuX7 was a gift from Morten Norholm (Addgene plasmid # 182364 ; http://n2t.net/addgene:182364 ; RRID:Addgene_182364) -
For your References section:
A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. Norholm MH. BMC Biotechnol. 2010 Mar 16;10:21. doi: 10.1186/1472-6750-10-21. 10.1186/1472-6750-10-21 PubMed 20233396