pcDNA6-MRPS6-VN172
(Plasmid
#182374)
-
PurposemVenus-based mito-riboBiFC vector
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182374 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 5060
- Total vector size (bp) 5978
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMrps6
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)918
-
Entrez GeneMrps6 (a.k.a. AW046321)
- Promoter CMV promoter
-
Tag
/ Fusion Protein
- VN172 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (destroyed during cloning)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA6-MRPS6-VN172 was a gift from Chunghun Lim (Addgene plasmid # 182374 ; http://n2t.net/addgene:182374 ; RRID:Addgene_182374) -
For your References section:
mtIF3 is locally translated in axons and regulates mitochondrial translation for axonal growth. Lee S, Park D, Lim C, Kim JI, Min KT. BMC Biol. 2022 Jan 7;20(1):12. doi: 10.1186/s12915-021-01215-w. 10.1186/s12915-021-01215-w PubMed 34996455