Skip to main content

pAAV-iCre-2A-venus
(Plasmid #182499)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182499 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 310
  • Total vector size (bp) 7459
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iCre-2A-Venus
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    4404
  • GenBank ID
    15186
  • Promoter fragment of histidine decarboxylase gene promoter that gives pan-neuronal expression

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (not destroyed)
  • 3′ cloning site Sal1 (not destroyed)
  • 5′ sequencing primer CATCCACTAAAGGGACTTCCAG
  • 3′ sequencing primer GTCAGCAGGTTGGAGACTTTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note there is a G6E in the insert. Depositor confirms this mutation does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-iCre-2A-venus was a gift from William Wisden (Addgene plasmid # 182499 ; http://n2t.net/addgene:182499 ; RRID:Addgene_182499)
  • For your References section:

    NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726