pAAV-flex-GFP-shRNA-scramble
(Plasmid
#182503)
-
PurposeExpresses scramble shRNA for control expts. Flexed cassette driven by pan neuronal gene promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6076
-
Vector typeMammalian Expression, AAV, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepan neuronal promoter driving flexed GFP-shRNA scramble from mir 30 cassette
-
SpeciesSynthetic
-
Insert Size (bp)3319
- Promoter hSyn promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Apa1 (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer aaactccccttcccggcc
- 3′ sequencing primer GAAGTTCACCTTGATGCCGTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note Addgene NGS identified a IS4 transposase element in this plasmid. Depositor confirms this does not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-flex-GFP-shRNA-scramble was a gift from William Wisden (Addgene plasmid # 182503 ; http://n2t.net/addgene:182503 ; RRID:Addgene_182503) -
For your References section:
NMDA Receptors in the Lateral Preoptic Hypothalamus Are Essential for Sustaining NREM and REM Sleep. Miracca G, Anuncibay-Soto B, Tossell K, Yustos R, Vyssotski AL, Franks NP, Wisden W. J Neurosci. 2022 May 31. pii: JNEUROSCI.0350-21.2022. doi: 10.1523/JNEUROSCI.0350-21.2022. 10.1523/JNEUROSCI.0350-21.2022 PubMed 35649726