piggybac-Syn-mScn8a-3xV5
(Plasmid
#182554)
-
PurposeExpresses Nav1.6 tagged with 3xV5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePiggybac
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameScn8a
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)6105
-
GenBank IDNM_001077499.2
-
Entrez GeneScn8a (a.k.a. C630029C19Rik, NaCh6, Nav1.6, dmu, med, mnd-2, mnd2, nmf2, nmf335, nmf58, nur14, seal)
- Promoter Syn
-
Tag
/ Fusion Protein
- 3xV5 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CAGCGGAGGAGTCGTGTCGT
- 3′ sequencing primer AAGACGGCAATATGGTGGAAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
piggybac-Syn-mScn8a-3xV5 was a gift from James Zhe Liu (Addgene plasmid # 182554 ; http://n2t.net/addgene:182554 ; RRID:Addgene_182554) -
For your References section:
Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149