Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry
(Plasmid #182560)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 182560 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Piggybac
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mouse Scn8a ICL1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1029
  • GenBank ID
    NM_001077499.2
  • Promoter Syn

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAGCGGAGGAGTCGTGTCGT
  • 3′ sequencing primer AAGACGGCAATATGGTGGAAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sfGFP-P2A-mCherry
  • Insert Size (bp)
    1485

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    piggybac-Syn-mScn8a_ICL1-sfGFP-P2A-mCherry was a gift from James Zhe Liu (Addgene plasmid # 182560 ; http://n2t.net/addgene:182560 ; RRID:Addgene_182560)
  • For your References section:

    Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More