Skip to main content

PX552-mScn8a-3xHA-Syn-smFP-flag
(Plasmid #182563)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 182563 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    PX552
  • Vector type
    AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    mouse Scn8a gRNA and 3xHA donor DNA
  • Species
    M. musculus (mouse)
  • GenBank ID
    NM_001077499.2
  • Promoter U6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TTCTTGGGTAGTTTGCAGTTTT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    smFP-flag
  • Insert Size (bp)
    1014
  • Promoter EF1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTACCTAGACTCAGC
  • 3′ sequencing primer CCGCAGGCCCTACAGGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX552-mScn8a-3xHA-Syn-smFP-flag was a gift from James Zhe Liu (Addgene plasmid # 182563 ; http://n2t.net/addgene:182563 ; RRID:Addgene_182563)
  • For your References section:

    Direct Observation of Compartment-Specific Localization and Dynamics of Voltage-Gated Sodium Channels. Liu H, Wang HG, Pitt GS, Liu ZJ. J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022. 10.1523/JNEUROSCI.0086-22.2022 PubMed 35672149

Ready-to-use antibodies

Looking for antibodies related to this plasmid? Check out these options:

Learn More