scAAV-Mlc2v-MPRA
(Plasmid
#182649)
-
PurposeSelf complementary AAV vector for high-throughput in vivo measurement of enhancer activity by massively parallel reporter assay
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneAAV
- Total vector size (bp) 4470
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCherry
- Promoter rat Mlc2v
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer cttcggtccgctttttggtac
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
scAAV-Mlc2v-MPRA was a gift from William Pu (Addgene plasmid # 182649 ; http://n2t.net/addgene:182649 ; RRID:Addgene_182649) -
For your References section:
A reference map of murine cardiac transcription factor chromatin occupancy identifies dynamic and conserved enhancers. Akerberg BN, Gu F, VanDusen NJ, Zhang X, Dong R, Li K, Zhang B, Zhou B, Sethi I, Ma Q, Wasson L, Wen T, Liu J, Dong K, Conlon FL, Zhou J, Yuan GC, Zhou P, Pu WT. Nat Commun. 2019 Oct 28;10(1):4907. doi: 10.1038/s41467-019-12812-3. 10.1038/s41467-019-12812-3 PubMed 31659164