-
PurposeExpresses CcaCas13b with N terminal 6xHis-SUMO tag for recombinant bacterial expression and purification
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneSUMO bacterial expression vector
- Backbone size w/o insert (bp) 6087
- Total vector size (bp) 9684
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCcaCas13b
-
SpeciesCapnocytophaga canimorsus
-
Insert Size (bp)3597
-
GenBank IDWP_013997271
- Promoter T7
-
Tag
/ Fusion Protein
- SUMO (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR0306 CcaCas13b His6-TwinStrep-SUMO was a gift from Feng Zhang (Addgene plasmid # 182687 ; http://n2t.net/addgene:182687 ; RRID:Addgene_182687) -
For your References section:
Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Gootenberg JS, Abudayyeh OO, Kellner MJ, Joung J, Collins JJ, Zhang F. Science. 2018 Apr 27;360(6387):439-444. doi: 10.1126/science.aaq0179. Epub 2018 Feb 15. 10.1126/science.aaq0179 PubMed 29449508