pPBO.ACT001
(Plasmid
#182711)
-
PurposeaTc inducible dCasRx
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182711 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep15a ORI
- Backbone size w/o insert (bp) 2761
- Total vector size (bp) 5716
-
Modifications to backboneN/A
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedCasRx
-
Alt namedRfxCas13d
-
Alt namedCas13
-
SpeciesRuminococcus flavefaciens XPD3002
-
Insert Size (bp)2955
-
MutationCatalytically deactivated R295A, H300A, R849A, H854A
-
GenBank ID891778
- Promoter pTet
-
Tag
/ Fusion Protein
- 2x-FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taagcagctctaatgcgc
- 3′ sequencing primer gatttcgtgatgcttgtcaggg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid pPBO.ACT001 was built using a dCasRx construct obtained from Emeric Charles at the University of California at Berkeley's labs of David Savage and Jennifer Doudna. Please cite the associated publication in any use of this plasmid: https://doi.org/10.1101/2021.05.26.445687. dCasRx was originally identified and created by Silvana Konnerman et al in the following publication. A variant of dCasRx can be obtained from Addgene deposit #109050. Please also cite the associated publication in any use of this plasmid: DOI: 10.1016/j.cell.2018.02.033
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This material is based upon work supported by the U. S. Department of Energy, Office of Science, through the Genomic Science Program, Office of Biological and Environmental Research, under the Secure Biosystems Design Initiative. Sandia National Laboratories is managed by National Technology and Engineering Solutions of Sandia, LLC., a wholly owned subsidiary of Honeywell International, Inc., for the U.S. Department of Energy under contract no. DE-NA-0003525.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBO.ACT001 was a gift from Joseph Schoeniger (Addgene plasmid # 182711 ; http://n2t.net/addgene:182711 ; RRID:Addgene_182711) -
For your References section:
CRISPR-RNAa: targeted activation of translation using dCas13 fusions to translation initiation factors. Otoupal PB, Cress BF, Doudna JA, Schoeniger JS. Nucleic Acids Res. 2022 Aug 11. pii: 6660959. doi: 10.1093/nar/gkac680. 10.1093/nar/gkac680 PubMed 35950485