-
PurposeDestabilized EGFP fluorescent reporter for Retinoic Acid activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGL3
- Backbone size w/o insert (bp) 3350
- Total vector size (bp) 4209
-
Modifications to backboneRARE element
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert named2EGFP
-
Alt namedestabilized EGFP
-
Insert Size (bp)850
- Promoter RARE, SV40
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer n/a
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Destabilized EGFP under the regulation of a Retinoic Acid Response Element. Half-life 2 hrs.
RARE is located before the SV40 promoter. RARE sequence: cagttgggtcatttgaaggttagcagcccgggtagggttcaccgaaagttcactcg
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3 RARE-d2EGFP was a gift from Chaya Kalcheim (Addgene plasmid # 183055 ; http://n2t.net/addgene:183055 ; RRID:Addgene_183055) -
For your References section:
Completion of neural crest cell production and emigration is regulated by retinoic-acid-dependent inhibition of BMP signaling. Rekler D, Kalcheim C. Elife. 2022 Apr 8;11. pii: 72723. doi: 10.7554/eLife.72723. 10.7554/eLife.72723 PubMed 35394423