Skip to main content

pLenti_EF1a_Flag_TP53_R248W
(Plasmid #183114)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183114 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-EF1α-Gate-PGK-hygromycin
  • Backbone manufacturer
    Gift
  • Backbone size w/o insert (bp) 10053
  • Total vector size (bp) 11232
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TP53
  • Alt name
    LFS1, Cellular Tumor Antigen P53
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1179
  • Mutation
    changed arginine 248 to tryptophan
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter EF1a
  • Tag / Fusion Protein
    • FLAG

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 3' EF1a-fwd: CTTCCATTTCAGGTGTCGTG
  • 3′ sequencing primer 3' PGK-rev: CTTTTGAAGCGTGCAGAATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_EF1a_Flag_TP53_R248W was a gift from William Kaelin (Addgene plasmid # 183114 ; http://n2t.net/addgene:183114 ; RRID:Addgene_183114)
  • For your References section:

    Sensitivity of VHL mutant kidney cancers to HIF2 inhibitors does not require an intact p53 pathway. Stransky LA, Vigeant SM, Huang B, West D, Denize T, Walton E, Signoretti S, Kaelin WG Jr. Proc Natl Acad Sci U S A. 2022 Apr 5;119(14):e2120403119. doi: 10.1073/pnas.2120403119. Epub 2022 Mar 31. 10.1073/pnas.2120403119 PubMed 35357972