Skip to main content

pBK092
(Plasmid #183146)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183146 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-His6-MBP-TEV-LIC cloning vector (1M)
  • Backbone manufacturer
    Scott Gradia
  • Backbone size w/o insert (bp) 6465
  • Total vector size (bp) 9391
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CrtSPARTA operon (6xHis-MBP-CrtTIR-APAZ and CrtAgo)
  • Alt name
    6xHis-MBP-CrtTIR-APAZ
  • Alt name
    CrtAgo
  • Species
    Crentalea thermophila: DSM 14807
  • Insert Size (bp)
    4049
  • GenBank ID
    WP_092459739.1 WP_092459742.1
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis (N terminal on insert)
    • MBP (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gatgaagccctgaaagacgcgcag
  • 3′ sequencing primer ttcgccaatccggatatagttcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK092 was a gift from Daan Swarts (Addgene plasmid # 183146 ; http://n2t.net/addgene:183146 ; RRID:Addgene_183146)
  • For your References section:

    Short prokaryotic Argonaute systems trigger cell death upon detection of invading DNA. Koopal B, Potocnik A, Mutte SK, Aparicio-Maldonado C, Lindhoud S, Vervoort JJM, Brouns SJJ, Swarts DC. Cell. 2022 Apr 28;185(9):1471-1486.e19. doi: 10.1016/j.cell.2022.03.012. Epub 2022 Apr 4. 10.1016/j.cell.2022.03.012 PubMed 35381200