pLV-rtTA-zeo
(Plasmid
#183233)
-
PurposeLentiviral vector expressing the rtTa gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183233 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbone3rd generation lentiviral vector
-
Backbone manufacturerFeng Zhang
-
Vector typeLentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA-T2A-Zeo
-
SpeciesSynthetic
- Promoter UBC
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aggcagggatattcaccatt
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe UBC-rtTA were amplified from the pHAGE-TRE-dCas9-KRAB (Addgene #50917)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-rtTA-zeo was a gift from Jorge Ferrer (Addgene plasmid # 183233 ; http://n2t.net/addgene:183233 ; RRID:Addgene_183233) -
For your References section:
The HASTER lncRNA promoter is a cis-acting transcriptional stabilizer of HNF1A. Beucher A, Miguel-Escalada I, Balboa D, De Vas MG, Maestro MA, Garcia-Hurtado J, Bernal A, Gonzalez-Franco R, Vargiu P, Heyn H, Ravassard P, Ortega S, Ferrer J. Nat Cell Biol. 2022 Oct 6. pii: 10.1038/s41556-022-00996-8. doi: 10.1038/s41556-022-00996-8. 10.1038/s41556-022-00996-8 PubMed 36202974