pET_scFv_QLuc
(Plasmid
#183261)
-
PurposeExpress scFv_QLuc in bacteria cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183261 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Total vector size (bp) 6548
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namescFv_QLuc
-
SpeciesSynthetic
-
Insert Size (bp)1335
- Promoter T7
-
Tag
/ Fusion Protein
- Histag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTAACTTTAAGAAGGAGATATACCATGGATGGGCAGCGATATTCAGATGAC
- 3′ sequencing primer AGTGGTGGTGGTGGTGGTGCTCGAGCGCCAGAATACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.05.23.493143 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET_scFv_QLuc was a gift from Huiwang Ai (Addgene plasmid # 183261 ; http://n2t.net/addgene:183261 ; RRID:Addgene_183261) -
For your References section:
Engineered Amber-Emitting Nano Luciferase and Its Use for Immunobioluminescence Imaging In Vivo. Xiong Y, Zhang Y, Li Z, Reza MS, Li X, Tian X, Ai HW. J Am Chem Soc. 2022 Aug 1. doi: 10.1021/jacs.2c02320. 10.1021/jacs.2c02320 PubMed 35913786