Skip to main content

pOC5 Tubb3-GFP KI
(Plasmid #183440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183440 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOC5
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA and GFP donor
  • gRNA/shRNA sequence
    GCTGCGAGCAACTTCACTT
  • Species
    M. musculus (mouse), R. norvegicus (rat)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer ctagtccgtttttagcgcgt
  • 3′ sequencing primer cgggccatttaccgtaagtt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOC5 Tubb3-GFP KI was a gift from Harold MacGillavry (Addgene plasmid # 183440 ; http://n2t.net/addgene:183440 ; RRID:Addgene_183440)
  • For your References section:

    Duplex Labeling and Manipulation of Neuronal Proteins Using Sequential CRISPR/Cas9 Gene Editing. Droogers WJ, Willems J, MacGillavry HD, de Jong APH. eNeuro. 2022 Jul 18;9(4):ENEURO.0056-22.2022. doi: 10.1523/ENEURO.0056-22.2022. 10.1523/ENEURO.0056-22.2022 PubMed 35851300