Skip to main content

pAAV-CaMKIIa-rsChRmine-eYFP-WPRE
(Plasmid #183531)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183531 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-CaMKIIa
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5384
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rsChRmine-eYFP
  • Species
    Synthetic; derived from Tiarina fusus
  • Insert Size (bp)
    1710
  • Mutation
    I146M/G174S
  • Promoter CaMKIIa

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTGGATGCTGACGAAGGCTCG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CaMKIIa-rsChRmine-eYFP-WPRE was a gift from Karl Deisseroth (Addgene plasmid # 183531 ; http://n2t.net/addgene:183531 ; RRID:Addgene_183531)
  • For your References section:

    Structural basis for channel conduction in the pump-like channelrhodopsin ChRmine. Kishi KE, Kim YS, Fukuda M, Inoue M, Kusakizako T, Wang PY, Ramakrishnan C, Byrne EFX, Thadhani E, Paggi JM, Matsui TE, Yamashita K, Nagata T, Konno M, Quirin S, Lo M, Benster T, Uemura T, Liu K, Shibata M, Nomura N, Iwata S, Nureki O, Dror RO, Inoue K, Deisseroth K, Kato HE. Cell. 2022 Feb 17;185(4):672-689.e23. doi: 10.1016/j.cell.2022.01.007. Epub 2022 Feb 2. 10.1016/j.cell.2022.01.007 PubMed 35114111