pPyCAG-NE-mKate2-IRES-Hph
(Plasmid
#183616)
-
PurposeMammalian expression vector: CAG promoter driving expression of nuclear envelope-tethered mKate2 (NLS-mKate2-EmerinTMD). Confers hygromycin B resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepPyCAG-IRES-Hph
- Backbone size w/o insert (bp) 6788
- Total vector size (bp) 7679
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKate2
-
SpeciesSynthetic
-
Insert Size (bp)891
- Promoter CAG
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- Human EMD transmembrane domain (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TGCTGGTTGTTGTGCTGT
- 3′ sequencing primer CGCACACCGGCCTTATTCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPyCAG-NE-mKate2-IRES-Hph was a gift from Sally Lowell (Addgene plasmid # 183616 ; http://n2t.net/addgene:183616 ; RRID:Addgene_183616) -
For your References section:
Nessys: A new set of tools for the automated detection of nuclei within intact tissues and dense 3D cultures. Blin G, Sadurska D, Portero Migueles R, Chen N, Watson JA, Lowell S. PLoS Biol. 2019 Aug 9;17(8):e3000388. doi: 10.1371/journal.pbio.3000388. eCollection 2019 Aug. 10.1371/journal.pbio.3000388 PubMed 31398189