pESC-LEU-SopB
(Plasmid
#183670)
-
PurposeInducible Salmonella Typhimurium SopB for expression in yeast
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepESC-LEU
-
Backbone manufacturerAgilent Technologies
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesopB
-
Alt namesigD
-
SpeciesSalmonella enterica serovar Typhimurium
-
Entrez GenesopB (a.k.a. STM1091)
- Promoter GAL1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aatatacctctatactttaacgtc
- 3′ sequencing primer ataaatagggacctagacttcagg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Galactose-inducible
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pESC-LEU-SopB was a gift from Sergio Grinstein (Addgene plasmid # 183670 ; http://n2t.net/addgene:183670 ; RRID:Addgene_183670) -
For your References section:
Kinase-independent synthesis of 3-phosphorylated phosphoinositides by a phosphotransferase. Walpole GFW, Pacheco J, Chauhan N, Clark J, Anderson KE, Abbas YM, Brabant-Kirwan D, Montano-Rendon F, Liu Z, Zhu H, Brumell JH, Deiters A, Stephens LR, Hawkins PT, Hammond GRV, Grinstein S, Fairn GD. Nat Cell Biol. 2022 Apr 28. pii: 10.1038/s41556-022-00895-y. doi: 10.1038/s41556-022-00895-y. 10.1038/s41556-022-00895-y PubMed 35484249