Ki67∆Nterm-mNeonGreen-IRESpuro2
(Plasmid
#183740)
-
PurposeExpresses Ki67∆Nterm-mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183740 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRESpuro2
- Backbone size w/o insert (bp) 5809
- Total vector size (bp) 12576
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMKI67 LR domain + all Ki-67 repeats
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6767
-
Entrez GeneMKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
- 3′ sequencing primer ATTCCAGCACACTGGATCA
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ki67∆Nterm-mNeonGreen-IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 183740 ; http://n2t.net/addgene:183740 ; RRID:Addgene_183740) -
For your References section:
Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Cuylen S, Blaukopf C, Politi AZ, Muller-Reichert T, Neumann B, Poser I, Ellenberg J, Hyman AA, Gerlich DW. Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610. 10.1038/nature18610 PubMed 27362226