EGFP-Ki67-mCherry
(Plasmid #183748)

• Purpose: Expresses EGFP-Ki67-mCherry
• Depositing Lab: Daniel Gerlich
• Publication: Cuylen et al Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610.

Backbone

• Vector backbone: pIRESpuro2
• Total vector size (bp): 16356
• Vector type: Mammalian Expression, Bacterial Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MKI67
• Species: H. sapiens (human)
• Insert Size (bp): 11250
• Entrez Gene: MKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Ki-67 with N-terminal EGFP tag (N terminal on insert)
  • Ki-67 with C-terminal mCherry tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAGAGCTGGTTTAGTGAACC
• 3′ sequencing primer: CTTAGCGCAGAAGTCATGCC

Resource Information

• Supplemental Documents:
  • 1371_Plasmid_183748_EGFP-Ki67-mCherry_IRESpuro2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry