Skip to main content

H2B-2A-GFP-IRESpuro2
(Plasmid #183746)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183746 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pIRESpuro2
  • Total vector size (bp) 6286
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_021058
  • Entrez Gene
    H2BC16P (a.k.a. H2BFIP, HIST1H2BPS2, pH2B.i, pH2B/i)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP with 2A protease cleavage site between H2B and GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer ATTCCAGCACACTGGATCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    H2B-2A-GFP-IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 183746 ; http://n2t.net/addgene:183746 ; RRID:Addgene_183746)
  • For your References section:

    Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Cuylen S, Blaukopf C, Politi AZ, Muller-Reichert T, Neumann B, Poser I, Ellenberg J, Hyman AA, Gerlich DW. Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610. 10.1038/nature18610 PubMed 27362226