EGFP-mCherry-Ki67
(Plasmid
#183750)
-
PurposeExpresses EGFP-mCherry-Ki67
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183750 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRESpuro2
- Total vector size (bp) 16330
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMKI67
-
SpeciesH. sapiens (human)
-
Entrez GeneMKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
- Promoter CMV
-
Tags
/ Fusion Proteins
- EGFP (N terminal on backbone)
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsrGI (destroyed during cloning)
- 3′ cloning site Pfl23II (destroyed during cloning)
- 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
- 3′ sequencing primer CTTAGCGCAGAAGTCATGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
EGFP-mCherry-Ki67 was a gift from Daniel Gerlich (Addgene plasmid # 183750 ; http://n2t.net/addgene:183750 ; RRID:Addgene_183750) -
For your References section:
Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Cuylen S, Blaukopf C, Politi AZ, Muller-Reichert T, Neumann B, Poser I, Ellenberg J, Hyman AA, Gerlich DW. Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610. 10.1038/nature18610 PubMed 27362226